Loading data
RNAvigate is built around the Sample, which is a grouping of datasets that came from a single RNA studied under a single set of experimental conditions. For example, a Sample could contain a sequence, primer location annotations, a ShapeMapper profile, and a predicted secondary structure for an in-vitro structure probing experiment. A second Sample could contain the same data for an in-vivo experiment.
Creating a Sample and assigning data files to it using data keywords accomplishes 4 tasks:
The data are organized as a Sample.
The data are easy to access via the assigned data keywords.
The data keyword tells RNAvigate how to parse and represent the data as one of the data classes described below.
The data is then compatible with all of RNAvigate’s visualization and analysis tools.
Data class |
Description |
|---|---|
sequence |
an RNA sequence |
annotation |
sites or regions of interest along an RNA sequence |
secondary structure |
the base-pairing pattern of an RNA sequence |
tertiary structure |
the 3D atomic coordinates of an RNA sequence |
profile |
per-nucleotide measurements along an RNA sequence |
interactions |
inter-nucleotide measurements within an RNA sequence |
Creating and using a Sample
Samples are created using rnav.Sample().
import rnavigate as rnav # Load RNAvigate and give it the alias "rnav"
my_sample = rnav.Sample( # create a new sample
sample="My sample name", # provide a name for plot labels
data_keyword="my_data.txt", # load data file 1
data_keyword2="my_other_data.txt", # load data file 2
)
Above, sample="My sample name" provides a label, to appear in plot titles and legends, for any data that came from this sample.
"My sample name" should be replaced with any string that uniquely and succinctly identifies this sample.
A sample label is always required.
data_keyword should be replaced with a data keyword appropriate for your specific data (see below).
Then, visualizing this data would look something like this:
plot = rnav.plot_arcs( # represent my data as an arc plot
samples=[my_sample], # visualize my_sample
sequence="data_keyword", # positionally align all data to this sequence
profile="data_keyword", # display profile data
structure="data_keyword2", # display secondary structure
)
plot_arcs can be replaced with other plotting functions, which are introduced in the next guide: Visualizing data.
Before we get into data keywords, rnav.Sample accepts two other arguments: inherit and keep_inherited_defaults.
These are used to share data between samples, e.g. a literature-accepted structure shared between experimental samples.
This sharing saves on memory and computation time.
Example usage:
shared_data = rnav.Sample(
name='shared data',
keyword1='big_structure.pdb')
sample1 = rnav.Sample(
name='knockout',
inherit=shared_data,
keyword2='sample1-data.txt')
sample2 = rnav.Sample(
name='control',
inherit=shared_data,
keyword2='sample2-data.txt')
sample1 and sample2 now both have keyword1, which is shared, and keyword2, which is not.
At the moment, default keywords are only used to simplify data keyword inputs. For
example, the ringmap data keyword uses the sequence provided by default_profile,
which is the first profile-type data provided to the Sample.
Data keywords
Data keywords can either be an arbitrary keyword or a standard keyword:
Arbitrary data keywords
An arbitrary keyword is useful if you are loading 2 or more of the same data type into a single sample. Arbitrary keywords must follow some simple rules:
Cannot conflict with a given sample’s other data keywords.
Cannot be
inheritorkeep_inherited_defaultsCannot consist only of valid nucleotides:
AUCGTaucgtCannot start with a number:
0123456789Must only contain numbers, letters and underscores.
If an arbitrary data keyword is used, a dictionary must be provided, specifying the standard data keyword to use for parsing inputs.
Example:
my_sample = rnav.Sample(
sample="example",
standard_keyword="input_file_1.txt",
arbitrary_keyword={"standard_keyword": "input_file_2.txt"}
)
Standard data keywords
Sequence data
sequence
an RNA sequence
example uses:
aligning data between sequences
all data in RNAvigate is associated with a sequence and can be aligned to other data, or vice versa.
input explaination:
Input should be a fasta file, a sequence string, or another data keyword. If another data keyword is provided, the sequence from that data is retrieved.
example inputs:
# fasta file
my_sample = rnav.Sample(
name="example",
sequence="path/to/my_sequence.fa",
)
# sequence string
my_sample = rnav.Sample(
name="example",
sequence="AUCAGCGCUAUGACUGCGAUGACUGA",
)
# data keyword
my_sample = rnav.Sample(
name="example",
data_keyword="some_data_with_a_sequence"
sequence="data_keyword",
)
back to Standard data keywords
Annotation data
motif
Annotation of occurances of a sequence motif
example uses:
highlighting nucleotides in skyline, profile, arc, circle, or secondary structure diagram plots
coloring nucleotides in circle plots, secondary structure diagrams, 3D molecule renderings, or linear regression scatter plots
input explaination:
Input should be a dictionary containing:
"motif": a string that uses the nucleotide alphabete.g.: “DRACH” for potential m6A modification sites
alphabet |
meaning |
matches |
|---|---|---|
A, U, C, G |
identity |
A, U, C, G |
B |
not A |
U/C/G |
D |
not C |
A/U/G |
H |
not G |
A/U/C |
V |
not U |
A/C/G |
W |
weak |
A/U |
S |
strong |
C/G |
M |
amino |
A/C |
K |
ketone |
U/G |
R |
purine |
A/G |
Y |
pyrimidine |
U/C |
N |
any |
A/U/C/G |
"sequence": same as sequence keyword
"color": a valid color or hexcode, e.g."blue","grey", or"#fa4ce2"
"name": an arbitrary name to use on plots
example inputs:
my_sample_1 = rnav.Sample(
sample="example1",
m6A={
"motif": "DRACH",
"sequence": "my_rna.fa",
"color": "blue",
"name": "m6A motif"
}
)
back to Standard data keywords
orfs
Annotation of open-reading frames
example uses:
same as motif
coming soon: displaying amino acid translation and codon usage scores
input explaination:
Input should be a dictionary containing:
"orfs":"all"annotates all open-reading frames"longest"annotates only the longest open reading frame
"sequence": same as sequence keyword"color": a valid color or hexcode, e.g."blue","grey", or"#fa4ce2""name": an arbitrary name to use on plots
example inputs:
my_sample_1 = rnav.Sample(
sample="example1",
main_orf={
"orfs": "longest",
"sequence": "my_sequence.fa",
"color": "green",
"name": "Longest ORF"
}
)
back to Standard data keywords
spans
Annotation of any regions of interest
example uses:
same as motif
input explaination:
input is a dictionary containing
"spans": a list of lists of 2 integers. Each inner list specifies astart and end position of a span (1-indexed, inclusive)
"sequence": same as sequence keyword"color": a valid color or hexcode, e.g."blue","grey", or"#fa4ce2""name": an arbitrary name to use on plots
example inputs:
my_sample_1 = rnav.Sample(
sample="example1",
regions={
"spans": [[10, 13], [65, 72]],
"sequence": "my_sequence.fa",
"color": "purple",
"name": "interesting regions"
}
)
back to Standard data keywords
sites
Annotation of any sites of interest
example uses:
same as motif
input explaination:
input is a dictionary containing
"sites": a list of nucleotide positions (1-indexed, inclusive)"sequence": same as sequence keyword"color": a valid color or hexcode, e.g."blue","grey", or"#fa4ce2""name": an arbitrary name to use on plots
example inputs:
my_sample_1 = rnav.Sample(
sample="example1",
m6a_sites={
"sites": [10, 13, 65, 72],
"sequence": "my_sequence.fa",
"color": "purple",
"name": "m6A sites"
}
)
back to Standard data keywords
group
Annotation of any group of nucleotides, such as a binding pocket
example uses:
same as motif
input explaination:
input is a dictionary containing
"group": a list of nucleotide positions (1-indexed, inclusive)"sequence": same as sequence keyword"color": a valid color or hexcode, e.g."blue","grey", or"#fa4ce2""name": an arbitrary name to use on plots
example inputs:
my_sample_1 = rnav.Sample(
sample="example1",
ligand_pocket={
"sites": [10, 13, 65, 72],
"sequence": "my_sequence.fa",
"color": "purple",
"name": "ligand-binding pocket"
}
)
back to Standard data keywords
primers
Annotation of primer binding sites
example uses:
same as motif
input explaination:
input is a dictionary containing
"primers": a list of lists of 2 integers. Each inner list specifies astart and end position of a primer (1-indexed, inclusive). A reverse primer is specified by listing the 3’ -> 5’ start and end, e.g. [300, 278]
"sequence": same as sequence keyword"color": a valid color or hexcode, e.g."blue","grey", or"#fa4ce2""name": an arbitrary name to use on plots
example inputs:
my_sample_1 = rnav.Sample(
sample="example1",
pcr_primers={
"primers": [[1, 22], [300, 278]],
"sequence": "my_sequence.fa",
"color": "purple",
"name": "primer-binding sites"
}
)
back to Standard data keywords
domains
Annotation of RNA domains
example uses:
same as motif
plus: labelling domains across the x-axis of skyline, profile, and arc plots
input explaination:
input is a dictionary containing
"domains": a list of lists of 2 integers. Each inner list specifies astart and end position of a primer (1-indexed, inclusive).
"sequence": same as sequence keyword"colors": a valid color or hexcode, e.g."blue","grey", or"#fa4ce2""names": an arbitrary name to use on plots
example inputs:
my_sample_1 = rnav.Sample(
sample="example1",
mrna_domains={
"domains": [[1, 62], [63, 205], [206,300]],
"sequence": "my_rna.fa",
"colors": ["purple", "green", "orange"],
"names": ["5'UTR", "CDS", "3'UTR"],
}
)
back to Standard data keywords
Secondary structure data
ss
A secondary structure with optional diagram drawing
example uses:
- visualizing base pairs on arc plots, circle plots, and secondary structure
diagrams
calculating contact distances
the shortest path between nucleotides in a secondary structure graph
determining how well per-nucleotide data predict base pairing status (AUROC)
input explaination:
Input should be one of the following formats:
secondary structure files (no diagram)
connection table (.ct)
dotbracket notation (.dot, .dbn, etc.)
secondary structure diagram files
StructureEditor (.nsd or .cte)
XRNA (.xrna)
VARNA (.varna)
FORNA (.json)
click “add molecule” and paste in a dotbracket notation structure.
arrange it how you like
click the download button in the lower-right, then click “json”
R2DT (.json)
Type in an RNA sequence, R2DT creates the secondary structure
Click on the R2DT paper link to learn more about how it works
Once the structure is drawn, click “Edit in XRNA”
Arrange it how you like it
In the upper-left, type in a file name, choose “json”, click “download”
Note: The file format is determined by the file extension. Since FORNA and R2DT both produce json, the extension should be provided.
example inputs:
my_sample_1 = rnav.Sample(
sample="example1",
ss="my_structure.ct"
)
other optional inputs:
"extension"is used to specify a file extension."autoscale"is used to scale coordinates to look good in RNAvigate plots"structure_number"is used to specify which structure to load if the filecontains multiple structures (0-indexed). Default is to load the first structure. This currently only works with dotbracket, ct, and NSD files.
typical optional argument examples:
# specify r2dt vs forna json
my_sample = rnav.Sample(
sample="example",
ss={
"ss": "my_rna.json",
"extension": "r2dt,
}
)
#specify structure number
my_sample = rnav.Sample(
sample="example",
ss={
"ss": "my_rna.ct",
"structure_number": 3,
}
)
back to Standard data keywords
Tertiary structure data
pdb
A tertiary structure with atomic coordinates
example uses:
rendering 3D molecules with data overlayed
computing 3D distances between nucleotides
input explaination:
Input should be a dictionary containing these keys:
“pdb”: a standard PDB file (.pdb or .cif)
“chain”: A chain ID
“sequence”: same inputs as sequence keyword
This is not needed if a sequence is found in the file header.
example inputs:
my_sample_1 = rnav.Sample(
sample="example1",
pdb={
"pdb": "my_structure.pdb",
"chain": "X",
"sequence": "my_rna.fa" # not needed if sequence in pdb header
}
)
back to Standard data keywords
Profile data
profile
per-nucleotide data that does not have a more specific data keyword:
shapemapfor SHAPE-, DMS-, or other MaP methoddancemapfor DanceMapper reactivitiesrnpmapfor RNPMapper dataprofilefor everything else
example uses:
visualizing per-nucleotide data on profile, skyline, or arc plots.
coloring nucleotides in a secondary structure diagram, circle plot, or 3D molecular rendering
calculating profile-to-profile linear regressions
calculating ROC curves
Renormalizing per-nucleotide data
input explaination:
These inputs allow a lot of customization in loading data.
For a full explaination, see Custom profiles
input_datacan also be a list of replicates. See Replicate averaging.
back to standard data keywords
shapemap
SHAPE, DMS, or other reagent per-nucleotide reactivities
Two similar data keywords:
- shapemap_rnaframework accepts an RNAframework xml file.
RNAframework files do not contain error estimates or raw data.
shapemap_N7Gaccepts a msDMS-MaPprofile.txtgafile.Produced by the msDMS-MaP pipeline.
- Non-guanosine positions are masked to NaN, and colormap/normalization
defaults are set for N7 of guanosine (N7G) reactivity rather than 2’-OH SHAPE chemistry.
example uses:
same as profile
plus: visualizing quality control metrics if a log file is specified
input explaination:
- Input should be a ShapeMapper2 profile.txt file. This file contains the most
complete per-nucleotide data from a ShapeMapper2 run.
"shapemap"can also be a list of replicate files. See Replicate averaging.
example inputs:
my_sample = rnav.Sample(
sample="example",
shapemap="shapemap_profile.txt"
)
other optional inputs:
"normalize":Defaults to not performing any renormalization.
"DMS"will perform DMS-MaP renormalization"eDMS"will perform eDMS-MaP renormalization"boxplot"will perform ShapeMapper2 renormalization (with 1 improvement)- By default, renormalization is performed on the HQ_profile and HQ_stderr
columns, and overwrites the Norm_profile and Norm_stderr columns
Normalization can also be done after
rnav.Samplecreation.
type:
help(rnav.data.Profile.normalize)
"log"is used to specify a log file. If ShapeMapper2 was run with the--per-read-histogramsflag, this file will contain read length distribution and mutations-per-read distribution. This data can then be visualized withrnav.plot_QC.
"metric","metric_defaults","sequence", and"read_table_kw"areexplained in Custom interactions, but are not recommended for standard ShapeMapper2 files.
typical optional input example:
my_sample = rnav.Sample(
sample="example",
shapemap={
"shapemap": "shapemap_profile.txt",
"log": "shapemap_log.txt",
}
)
back to Standard data keywords
dancemap
Reactivity profile of a single component of a DanceMapper model
example uses:
same as profile
input explaination:
Input should be a dictionary containing:
"dancemap": the DanceMapper reactivities.txt file"component"`: which component of the DANCE model to load
This works best if each component is a seperate
rnav.Sample
example inputs:
my_sample_1 = rnav.Sample(
sample="example1",
dancemap={
"dancemap": "mydancemap_reactivities.txt",
"component": 0},
)
my_sample_2 = rnav.Sample(
sample="example2",
dancemap={
"dancemap": "mydancemap_reactivities.txt",
"component": 1},
)
other optional inputs:
"metric","metric_defaults","sequence", and"read_table_kw"are explained in Custom profiles, but are not recommended for standard DanceMapper files.
back to Standard data keywords
rnpmap
RNP-MaP per-nucleotide reactivities.
example uses:
same as profile
input explaination:
Input should be the output csv file from RNPMapper
"rnpmap"can also be a list of replicate csv files. See Replicate averaging.
example inputs:
my_sample_1 = rnav.Sample(
sample="example1",
rnpmap="myrnpmap_output.csv",
)
other optional inputs:
"metric","metric_defaults","sequence", and"read_table_kw"are explained in Custom interactions, but are not recommended for standard RNPMapper files.
back to standard data keywords
Interactions data
interactions
inter-nucleotide data that does not have a more specific data keyword:
ringmap for RingMapper correlations
pairmap for PairMapper correlations
shapejump for ShapeJump deletion events
pairprob for pairing probabilities
allpossible for every possible nucleotide pairing from a sequence
interactions: for everything else
example uses:
- visualizing interaction networks in arc and circle plots, secondary structure
diagrams and 3D molecule renderings
filtering interactions based on many different factors.
see :doc:’/guides/filters’ guide.
calculating a distance distribution histogram of a set of interactions
input explaination:
These inputs allow a lot of customization in loading data.
For a full explaination, see Custom interactions
back to standard data keywords
ringmap
single-molecule correlations from a DMS- or eDMS-MaP experiment
A similar data keyword, ringmap_N7G, accepts a concat_rings.txt file produced
by the msDMS-MaP pipeline. Positions involving N7 of guanosine (N7G) are decoded back
to their true nucleotide indices by subtracting the RNA length from any i/j values that
are greater than the RNA length, and a Type column is added to classify each RING
as "N1N1", "N7N1", "N1N7", or "N7N7", where the order indicates which of
i (first) and j (second) is the N7G position. Use Type_eq and Type_ne
filter kwargs when plotting to separate backbone (N1/N1) and N7G-involving correlations.
example uses:
same as interactions
input explaination:
Input should be the correlations file output from RingMapper.
example inputs:
my_sample_1 = rnav.Sample(
sample="example1",
ringmap="myringmap_corrs.txt",
)
other optional inputs:
"sequence"is used to specify the sequence, and accepts the same inputsas the sequence keyword. Defaults to
"default_profile", the first profile added to the RNAvigate Sample.
"metric","metric_defaults","read_table_kw", and"window"areexplained in Custom interactions, but are generally not recommended for RingMapper files.
typical optional input example:
my_sample = rnav.Sample(
sample="example",
ringmap={
"ringmap": "myringmap_corrs.txt"
"sequence": "my_rna.fa"
}
)
back to Standard data keywords
pairmap
single-molecule correlations from a DMS- or eDMS-MaP experiment reflective of base pairing
PairMapper software (part of RingMapper)
example uses:
same as interactions
input explaination:
Input should be the pairmap.txt output file from PairMapper.
example inputs:
my_sample = rnav.Sample(
sample="example",
pairmap="mydata_pairmap.txt",
)
other optional inputs:
"sequence"is used to specify the sequence, and accepts the same inputs as the sequence keyword"metric","metric_defaults","read_table_kw", and"window"are explained in Custom interactions, but are generally not recommended for PairMapper files
typtical optional input example:
my_sample = rnav.Sample(
sample="example",
pairmap={
"pairmap": "mydata_pairmap.txt",
"sequence": "my_rna.fa",
}
)
back to Standard data keywords
shapejump
ShapeJump inter-nucleotide RT deletion events
example uses:
same as interactions
input explaination:
Input should be the deletions.txt output file from ShapeJumper.
example inputs:
my_sample_1 = rnav.Sample(
sample="example1",
shapejump="mydata_deletions.txt",
)
other optional inputs:
"sequence"is used to specify the sequence, and accepts the same inputs as the sequence keyword"metric","metric_defaults","read_table_kw", and"window"are explained in Custom interactions, but are generally not recommended for ShapeJumper files.
typical optional argument example:
my_sample = rnav.Sample(
sample="example",
shapejump={
"shapejump": "mydata_deletions.txt",
"sequence": "my_rna.fa",
}
)
back to Standard data keywords
pairprob
inter-nucleotide predicted pairing probabilities
example uses:
same as interactions
plus: calculating shannon entropy
input explaination:
- Input should be a dotplot plain text file from running RNAstructure
partitionfollowed byProbabilityPlotwith-toption
For example:
partition my_sequence.fa pair_probabilities.dp
ProbabilityPlot -t pair_probabilities.dp pair_probabilities.txt
example inputs:
my_sample_1 = rnav.Sample(
sample="example1",
pairprob={"pairprob": "pair_probabilities.txt",
"sequence": "my_sequence.fa"}
)
other optional inputs:
"sequence"is used to specify the sequence, and accepts the same inputs as the sequence keyword"metric","metric_defaults","read_table_kw", and"window"are explained in Custom interactions, but are generally not recommended for “” files
typical optional argument example:
my_sample = rnav.Sample(
sample="example",
pairprob={
"pairprob": "pair_probabilities.txt",
"sequence": "my_rna.fa",
}
)
back to Standard data keywords
allpossible
All possible inter-nucleotide pairings for a given sequence
example uses:
same as interactions
plus: calculating the expected distance distribution of a filtering scheme
input explanation:
This keyword has the same expected inputs as the sequence keyword.
Note: the size of the data increases with the sequence length squared.
example inputs:
my_sample_1 = rnav.Sample(
sample="example1",
allpossible="my_rna.fa"
)
other optional inputs:
"window"is used to specify the window size of the interacting regions.Default:
"window": 1means nucleotide i to nucleotide j"window": 3means nucleotides i:i+3 to nucleotides j:j+3
"metric","metric_defaults", and"read_table_kw"are explained
typical optional argument example:
my_sample = rnav.Sample(
sample="example",
allpossible={
"allpossible": "my_rna.fa",
"window": 3,
}
)
back to Standard data keywords